quarta-feira, 28 de setembro de 2016

Ciências Naturais - Powerpoint sobre Biotecnologia


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Resumo sobre a Tectónica de Placas


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Resumo sobre o Aparecimento da Vida na Terra


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Resumo sobre o Vulcanismo


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Resumo sobre os Fósseis


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Teste de Avaliação sobre Factores Abióticos


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ficha de Trabalho sobre as Rochas


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Teste de Avaliação sobre as Rochas


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre Material Genético


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Vídeo sobre Mendel e as leis da hereditariedade

domingo, 18 de setembro de 2016

Ciências Naturais - Powerpoint sobre Hereditariedade e DNA


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre Ácidos Nucleicos


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Vídeo sobre Hereditariedade e DNA

Noções Básicas de Hereditariedade


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Hereditariedade - Estruturas da Vida


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre Hereditariedade


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre Património Genético


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre Património Genético - Revisões


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre Património Genético - Trabalhos de Mendel


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre Sismologia


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Vídeo sobre os Trabalhos de Mendel

Ciências Naturais - Esquema da Estrutura do ADN

Ciências Naturais - Esquema do ADN e dos Nucleótidos

Ciências Naturais - Vídeo sobre Hereditariedade

Ciências Naturais - Vídeo sobre os Benefícios da Actividade Vulcânica

Viajando pelos Mares Primitivos

Powerpoint sobre a Tectónica de Placas


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Powerpoint sobre a Tectónica de Placas


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Vídeo sobre a Tectónica de Placas e o Vulcanismo

Vídeo sobre as Placas Tectónicas

Vídeo sobre a Deriva continental! Da Pangeia ao futuro em pouco mais de um minuto!

Vídeo sobre Tectónica de Placas e Deriva Continental

Ciências Naturais - Algumas medidas para ter uma boa alimentação!

O nosso bem estar passa, também, por uma alimentação saudável. Podemos começar por aproveitar os alimentos da época, para ir variando ao longo do ano, mas não só. Aqui ficam algumas medidas que nos podem ajudar a manter a saúde:
1- Utilizar alimentos de qualidade: limpos e frescos;
2- Tomar sempre o pequeno-almoço;
3- Incluir nas refeições alimentos de todos os sectores da roda dos alimentos, nas proporções por ela sugeridas;
4- Variar o mais possível de alimentos;
5- Não passar mais de três horas e meia sem comer;
6- Evitar alimentos com muito sal;
7- Evitar alimentos açucarados (bolos, rebuçados, refrigerantes, etc.);
8- Evitar os fritos ou comida com muita gordura;
9- Consumir diariamente sopa (...faz muito bem...);
10- Preferir pão escuro (mistura de centeio e trigo) do tipo saloio ao pão mais branco (trigo);
11- Beber líquidos em abundância (água simples, limonada ou refrescos sem açúcar e chás);
Comer tudo com calma, mastigando bem os alimentos, enquanto se vai conversando com os amigos ou a família. Bom apetite!

Love Earth



No dia 22 de Abril comemora-se o Dia Mundial da Terra. Só para lembrar o quanto bonita é a Terra, os seres vivos e os ecossistemas, aqui fica um pequeno vídeo!
Foi em 1970, nos Estados Unidos, que o senador G. Nelson convocou um protesto contra a poluição. A partir de 1990, o dia 22 de Abril é comemorado como Dia da Terra também por outros países. Este dia é dedicado à Terra em especial para lembrar a necessidade e a importância de preservar e conservar a natureza e os ecossistemas do nosso planeta.

Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre Mendel e a Hereditariedade


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Documento com exemplos de Fósseis de Animais Vivos


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Vídeos sobre os neurónios e os impulsos nervosos


Ciências Naturais - Vídeo sobre o Sistema Nervoso Central

Ciências Naturais - Vídeos sobre o corpo humano - Sistema Nervoso






Resumo sobre os Fósseis


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Powerpoint sobre os Fósseis - A Terra conta a sua História


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box



Os Fósseis e a Paleontologia

Ciências Naturais - Vídeo sobre Hereditariedade

Ciências Naturais - Vídeo sobre Hereditariedade e DNA

Ciências Naturais - Powerpoint sobre o Sistema Circulatório



Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Vídeo sobre Vulcões Assassinos

Ciências Naturais - Powerpoint sobre o Sistema Respiratório


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre Hereditariedade


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - ADN - Símbolo de Vida

ADN, Ácido DesoxirriboNucleico, é uma molécula biológica universal presente em todas as células vivas. É no ADN que está contida toda a nossa informação genética, sob a forma de genes. O ADN é constituído por quatro tipos de nucleótidos , unidade básica do ADN (que por sua vez é constituído por uma pentose, um grupo fosfato e uma base azotada), que se associam de uma forma específica, formando uma cadeia dupla: adenina (A) com timina (T) e guanina (G) com citosina (C). Os nucleótidos são designados deste modo devido às bases azotadas que entram nas suas constituições. É possível ler a cadeia de ADN, obtendo-se uma sequência de letras, como por exemplo, ATGATTCTGTAGCCTGATCCC,  a uma sequência completa de ADN dá-se o  nome de genoma.
O ADN tem a forma de uma escada de corda enrolada helicoidalmente, ou seja, de uma hélice dupla em que os degraus são formados por pares de bases azotadas ligadas entre si, através de ligações de hidrogénio, com fundamento na complementaridade de bases. A estrutura, do ADN, foi proposta há 53 anos por James Watson e Francis Crick. A descoberta da estrutura do ADN abriu o caminho para se compreender como é que a informação genética é transmitida de progenitores para descendentes, ou de uma célula para outra, isto é, como funciona a hereditariedade.
Hoje em dia, esta descoberta tem um impacto em muitas áreas da vida moderna, tais como a medicina, a reprodução, a alimentação, a longevidade e o ambiente. No caso da medicina, e da saúde, há milhares de doenças hereditárias diferentes: cada uma resulta de um defeito num gene, muitos dos quais agora conhecemos. Assim, sabe-se detectar esses defeitos antes da nascença e tem-se esperança de os poder corrigir dentro de algum tempo, utilizando a terapia génica. Os testes genéticos permitem prever as doenças genéticas a que um indivíduo está mais sujeito e preveni-las a tempo. A amniocentese é um exemplo de um teste genético pré-natal que é muito usado para detectar se um bebé irá sofrer o síndroma de Down, mais conhecido como mongolismo, e que resulta da duplicação do cromossoma 21. Outro exemplo de influência genética é na reprodução, são as  técnicas de fertilização in vitro (FIV) que permitem que hoje muitos casais inférteis possam ter filhos. Aliado à FIV está o diagnóstico genético preimplantatório, que permite detectar, nos embriões, erros no ADN que causam doenças, reduzindo-se assim a probabilidade de a criança nascer com uma doença genética. Este diagnóstico não pode, contudo, ser usado para excluir embriões com características estéticas e sociais não desejadas, como por exemplo, cor dos olhos, sexo ou inteligência. Outro assunto em que a genética influencia é na alimentação pois através da engenharia genética é agora possível produzir alimentos mais baratos, mais energéticos e mais res istentes a pragas e à seca, sem poluir o ambiente nem gastar tanta água. Igual interferência genética dá-se na longevidade celular, resta agora continuar estes estudos de forma a descobrir como se impede o envelhecimento das células e como se reparam os estragos naturais das células velhas, estudos elaborados na mosca da fruta e numa espécie de lombrigas já identificaram certos genes responsáveis pelo prolongamento da longevidade. No ambiente o ADN é uma importante ferramenta para se salvarem espécies de animais e de plantas em perigo de extinção e mesmo para se trazerem de volta algumas que tenham desaparecido recentemente. O ADN traz a possibilidade de se criarem novas bactérias geneticamente modificadas que sejam capazes de limpar o ambiente de toxinas nocivas, pois decompõem resíduos orgânicos (nocivos para o ambiente) e transformam-nos em água e dióxido de carbono.
É, também, através do ADN, que se podem criar os «bilhetes de Identidade genéticos» isto é, a partir dos genes de ADN que se encontram no núcleo das nossas células é possível reconhecer a nossa identidade de uma maneira que ninguém o possa negar, pois o nosso ADN é único. Ou então pode-se verificar a vericidade dos progenitores, com o teste de paternidade.

Ciências Naturais - Conceito de Ácido Desoxirribonucleico (ADN ou DNA)

O Ácido Desoxirribonucleico (sigla: ADN; ou em inglês: DNA) é um ácido nucleico que contém toda a informação genética de cada indivíduo, nomeadamente de todos os seres celulares e de grande parte dos vírus. Este ácido consiste numa molécula formada por duas cadeias antiparaledas (em forma de dupla hélice) ligadas entre si por ligações de hidrogénio entre as bases azotadas e é constituído por unidades alternadas de desoxirribonucleótidos, os quais, por sua vez, são constituídos por um açúcar (a desoxirribose), um grupo fosfato e a referida base azotada (ou nitrogenada); esta base pode ser uma purina (Adenina e Guanina) ou uma pirimidina (Timina e Citosina). A Adenina está ligada com a Timina por 2 ligações de hidrogénio e a Guanina com a Citosina com 3 ligações de hidrogénio.

O ADN encontra-se no núcleo das células, nas mitocôndrias e nos cloroplastos e à sequência completa do ADN de cada célula é dada a designação de genoma. O seu principal papel no organismo é o de armazenar as informações necessárias para a síntese e replicação das proteínas. A síntese de proteínas consiste na produção das proteínas que as células e os vírus precisam para o metabolismo e desenvolvimento. A replicação designa o conjunto de reacções por meio das quais o ADN faz uma cópia de si mesmo de cada vez que uma célula se divide e transmite as suas informações às células filhas. Em quase todos os organismos celulares o ADN está organizado na forma de cromossomas, situados no núcleo celular.

A descoberta da estrutura da molécula de ADN foi efectuada em Março de 1953 pelo norte-americano James Watson e pelo britânico Francis Crick, descoberta que lhes valeu o Prémio Nobel da Medicina em 1962, juntamente com Maurice Wilkins.

Ciências Naturais - Vídeo sobre Genética

Ciências Naturais - Ficha de Trabalho sobre Hereditariedade


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Teste de Avaliação sobre os Sistemas Respiratório e Digestivo


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Teste de Avaliação sobre as Rochas


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Teste de Avaliação sobre Factores Abióticos


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

sábado, 17 de setembro de 2016

Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Powerpoint sobre a Tectónica de Placas


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box



Teste de Avaliação - Ambientes / Células


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Esquema do Cariótipo Humano























Ciências Naturais - Powerpoint sobre Hereditariedade


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - Ficha de Trabalho sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - Powerpoint sobre o Sistema Neuro-Hormonal


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Powerpoint sobre a Mobilidade dos Continentes


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box

Ciências Naturais - O Sistema Nervoso

A nossa sobrevivência depende, em primeira instância, de uma infinidade de reflexos, esses gestos automáticos que podemos treinar para torná-los mais eficazes e evitar que se deteriorem à medida que a idade avança.

Final de uma importante competição futebolística. O desafio saldou-se por um empate. As equipas disputam a vitória num tenso duelo de grandes penalidades. Um dos guarda-redes resiste melhor à pressão, adivinha a trajectória de quatro remates e consegue evitar dois golos, averbando o título para a sua equipa. Intuição, sorte? Na opinião dos neurologistas, é tudo uma questão de reflexos, um fenómeno abrangido pela capacidade motora de reacção do indivíduo.

Embora com origem no córtex cerebral, pois requer uma percepção a esse nível e um processamento relativamente complexo, este tipo de reacção é quase inconsciente quando a actividade é repetida, estereotipada e treinada. É por isso que podemos conduzir de forma automática, ou que o guarda-redes consegue chegar à bola e defender o penalty quase sem ter consciência do que está a fazer.

Por outro lado, é habitual associar-se o reflexo ao tempo de reacção perante um estímulo. É claro que tem de haver uma percepção, visual ou auditiva, uma decisão e uma resposta, mas, de acordo com os especialistas em medicina do desporto, embora a antecipação seja importante, é possível melhorar essa capacidade ao trabalhar a força explosiva do atleta e através de treinos específicos, destinados a avaliar as suas reacções aos estímulos. No caso de estar relacionado com a visão, treina-se o sentido da vista para o atleta se concentrar nos objectivos importantes.

Recentemente, comprovou-se, por exemplo, que a capacidade visual dos jogadores de ténis está muito desenvolvida. Roger Federer ou Rafael Nadal são extremamente rápidos e certeiros a processar imagens, o que lhes permite maior precisão quando necessitam de reconhecer objectos em movimento e tomar decisões sob pressão. "São muito mais rápidos a detectar a velocidade de um objecto móvel e, também, a decidir quando o tempo urge", explica Leila Overney, do Laboratório de Neurociência Cognitiva da Escola Politécnica Federal de Lausana (Suiça).

O melhor será, sem dúvida, que se possa exercitá-los. Um guarda-redes terá tanto mais reflexos, no sentido da rapidez de reacção motriz, quanto mais treinar. De igual modo, não conseguimos pontuar tanto num jogo de vídeo da primeira vez do que acontece quando já o conhecemos de cor e salteado.

Todavia, a prática não só permite melhorar os reflexos em geral como, sobretudo, aquele que foi treinado específica e sucessivamente. Por outras palavras, um guarda-redes de um clube de futebol não tem de possuir os reflexos indispensáveis para brilhar no ténis, nem um tenista saber defender grandes penalidades: como é evidente, cada pessoa possui determinada capacidade para um desporto, e não para outro.

Por serem decisões conscientes que requerem uma percepção cortical (do nosso córtex cerebral) e posterior processamento, considera-se que a actividade motora complexa se torna semi-automática ou inconsciente quando os gânglios basais (massa cerebral situada na zona profunda dos hemisférios) assumem o respectivo comando.

No entanto, a capacidade de reacção não é apenas importante no desporto. Os neurologistas recordam que os reflexos são fundamentais para a nossa sobrevivência no quotidiano, podendo ser definidos como "movimentos involuntários, rápidos e estereotipados, provocados por um estímulo"; consoante a natureza deste último, podem ser visuais, vestibulares, auditivos, posturais... Por outro lado, as vias reflexas possuem uma componente sensorial que se encarrega de receber a informação e transportá-la até à medula espinal, e um componente efector, que a transmite da medula ao músculo adequado.

Os reflexos são padrões hereditários de comportamentos comuns a toda uma espécie. Através deles, obtemos respostas simples, rápidas e automáticas para a defesa de uma parte ou de todo o corpo diante de um estímulo potencialmente lesivo", explica a dra. Victoria González, uma neurofisióloga espanhola cujos estudos sobre o chamado "reflexo auditivo de sobressalto" (que consiste na contracção generalizada de amplos grupos musculares perante um estímulo sonoro intenso e inesperado) confirmam como são indispensáveis. "Esse abalo brusco, ou susto, é rapidíssimo (ocorre em milésimos de segundo) e é acompanhado de uma reacção do sistema nervoso autónomo: uma descarga de adrenalina e um começo de hiperventilação. Depois, pode produzir-se uma reacção defensiva ou orientativa", explica a especialista.

O reflexo localiza a fonte acústica; se for intensa, os pequenos ossos do aparelho auditivo retesam-se automaticamente para que entre menos som no ouvido interno. Deste modo, protegem-se as células ciliadas, que transformam as vibrações em impulsos eléctricos; distingue-se melhor a acústica de intensidade elevada e ficamos em alerta.

O reflexo auditivo de sobressalto já se pode observar no início da vida. Por exemplo, os bebés com dois meses, que se assustam com o próprio choro, reagem aos ruídos estendendo os braços para a frente, com as palmas das mãos voltadas para cima e os polegares flectidos. Aliás, quando se bate com a mão suavemente junto da cabeça, o bebé abre e fecha os braços. A verdade é que os actos reflexos são considerados um sinal de evolução do próprio feto, nomeadamente no último trimestre de gestação, altura em que o sistema nervoso se torna maduro. São designados por "reflexos arcaicos" e desaparecem dois ou três meses depois do parto. Esses reflexos primitivos que podemos observar no recém-nascido (como o de sucção, da marcha automática, da preensão palmar e plantar, do abraço, etc.) são de origem cerebral e inatos.

As reacções do neonato traduzem-se em movimentos automáticos, que partem do tronco encefálico (a parte mais primitiva do cérebro) e não envolvem qualquer participação cortical, ou seja, não são controlados voluntariamente. Alguns gestos, como chupar o dedo ou dar pequenos pontapés, surgem ainda no ventre materno; quando decidem abandoná-lo, os reflexos ajudam o feto a colocar-se na posição adequada, dar a volta e descer pelo canal do parto.

Todavia, isto é só o começo. Pouco depois de nascer, o bebé já consegue mamar, graças ao reflexos de sucção e deglutição. Em seguida, os gestos primitivos são gradualmente substituídos por outros posturais, como o reflexo tónico assimétrico do pescoço, que relaciona o movimento da cabeça para um lado com o do braço equivalente, o qual se estica, o que se revela muito útil quando se está voltado de barriga para baixo.

A ausência de reflexos primitivos no recém-nascido pode ser indício de alterações neurológicas ou do sistema nervoso. A fim de comprovar o seu correcto funcionamento, o pediatra recorre a uma série de testes, como pô-lo de pé sobre uma superfície dura: o reflexo será inclinar-se e dar alguns passos. Outro teste será meter-lhe o dedo na boca para comprovar se tem o reflexo de sucção, se engole saliva e se volta a cabeça na sua direcção.

Embora estas reacções desapareçam passado algumas semanas, podem voltar a surgir na idade adulta, devido a doenças ou acidentes. Existe um teste (conhecido por "sinal de Babinski") para detectar uma eventual lesão mental ou uma paralisia cerebral: se se estimular a planta do pé e o dedo grande se separar dos outros e flectir para cima (o que é normal em crianças até aos dois anos), constitui um indício de lesão nas vias nervosas que ligam a medula espinal ao cérebro.

Por outro lado, alguns distúrbios neurológicos que produzem lesões no lóbulo frontal, como os acidentes vasculares cerebrais ou a demência frontotemporal, têm como consequência o aparecimento dos referidos reflexos primitivos, indício de que se está a gerar uma doença neurodegenerativa.

Seja como for, os reflexos mais estudados são os osteotendinosos, detectados através da percussão, com um pequeno martelo, de um tendão como o patelar ou rotuliano (no joelho), ou o bicipital (na prega do cotovelo). Com a extensão brusca do músculo, os receptores sensitivos activam-se e enviam um sinal à medula espinal, onde o neurónio-receptor entra em contacto com o neurónio-motor. É desta forma que evitamos esticar bruscamente os músculos para manter o equilíbrio; ou seja, quando estamos de pé, os nossos músculos impedem automaticamente a perda de postura, contraindo-se para evitar a descompensação.

Assim, o teste aos reflexos osteotendinosos destina-se a fornecer-nos informação sobre o funcionamento dos nervos periféricos sensitivos, a medula espinal e o controlo desses reflexos pelo córtex. Através do teste, fica-se a saber, entre outras coisas, que o nível quatro lombar está bem, isto é, que nem os neurónios sensitivos nem os motores desta região da medula sofreram qualquer alteração.

Do mesmo modo que os reflexos arcaicos podem ressurgir por causa de alguma doença, os osteotendinosos podem desaparecer devido a um problema que afecte os nervos periféricos, como a neuropatia diabética. Por sua vez, uma lesão no córtex cerebral pode provocar, em determinados casos, hiperreflexia ou reflexos exagerados. Todavia, mesmo que não haja qualquer problema de saúde, é normal que, com a idade (a partir dos 40 anos, segundo os especialistas), os reflexos comecem a tornar-se progressivamente mais lentos, embora sem afectar a qualidade de vida.

Na velhice, a situação muda. Os idosos têm, naturalmente, uma actividade motora mais lenta, mas certos sintomas, como quedas frequentes, movimentos desajeitados, lentidão em falar, dificuldade em tomar decisões ou inexpressividade facial podem constituir indícios de uma doença degenerativa. Alguns reflexos, como os que controlam a postura, começam a perder-se com a idade, o que favorece as quedas. A verdade é que, na história destes mecanismos automáticos, alguns vão ficando irremediavelmente para trás.

Os reflexos são a resposta do organismo para proteger os sentidos das agressões do meio. Eis alguns dos mais importantes:

Posturais e tónicos. Mantêm a cabeça direita e o corpo na vertical. Utilizam informação do aparelho vestibular, que indica a posição da cabeça no espaço (reflexos vestibulares), e dos receptores nos músculos do pescoço, os quais indicam se estiver flectido (cervicais).

Superficiais ou cutâneos. São desencadeados por estimulação da pele, das mucosas e da córnea. Incluem o reflexo pupilar (dilatação da pupila perante uma dor).

Fotomotor. Contracção da pupila devido a um estímulo luminoso.

Corporais visuais. Movimentos exploratórios dos olhos e da cabeça para ler, por exemplo; e dos olhos, da cabeça e do pescoço perante um estímulo visual. Incluem ainda o reflexo do pestanejo diante de um eventual perigo.

Auditivo. Perante um ruído demasiado forte, favorece a rigidez automática dos pequenos ossos do ouvido, de forma a passar menos som para o ouvido interno

Tussígeno. A irritação da laringe, da traqueia ou dos brônquios produz tosse para eliminar secreções e corpos estranhos.

Nauseoso. Produz vómitos quando se estimula a garganta ou a parte posterior da boca.

Do espirro. Ajuda a expulsar ar e partículas quando as vias nasais ficam irritadas.

Do bocejo. Surge quando o organismo precisa de oxigénio suplementar.

J.M.D.super interessante 148

Ciências Naturais - Powerpoint sobre Sismologia


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências naturais - Powerpoint sobre Sismologia


Download 1 - Dropbox
Download 2 - Mega
Download 3 - Google Drive
Download 4 - Box


Ciências Naturais - O Sistema Respiratório

O sistema respiratório é constituído pelas fossas nasais, pela boca, laringe, traqueia, brônquios e pulmões. O tecido pulmonar é constituído por uma grande quantidade de alvéolos. Por sua vez, a parede dos alvéolos é atapetada por uma membrana respiratória ao nível da qual se processam as trocas gasosas. Assim, os pulmões funcionam como o interface entre o meio gasoso e o meio líquido que é o sangue, pois é neles que este se enriquece de oxigénio e elimina o dióxido de carbono.

A respiração compõe-se de três partes: a entrada de ar ou inspiração, a apneia que é uma pequena paragem e a expiração, ou seja, a saída do ar. Para respirar é indispensável efectuar movimentos ao nível da caixa torácica que possibilitem a inspiração e expiração. Os músculos intercostais, escalenos, abdominais e o diafragma entre outros, asseguram os movimentos necessários.


As vias respiratórias são constituídas por uma série de dutos que permitem ao ar passar do ambiente externo aos pulmões e vice-versa. O ar entra pelo nariz percorre as fossas nasais e passa para a faringe; daí desce pela laringe que é continuada pela traqueia. Esta, chegando no tórax, se bifurca em dois ramos, o brônquio direito e o brônquio esquerdo que chegam aos respectivos pulmões. Para a respiração contribui também a caixa torácica, da qual os movimentos de expansão e de redução são essenciais para que o ar possa entrar e sair das vias respiratórias.
Fossas nasais e faringe, mesmo fazendo parte das vias respiratórias, desempenham ainda outras funções: as fossas nasais são a sede do sentido do olfacto, enquanto a faringe pode ser considerada também um órgão do aparelho digestivo desde que por ela (ou melhor, pela porção faringe que está atrás da boca) passa o bolo alimentar, além do ar.
A laringe, a traqueia, os brônquios e os pulmões são, ao contrário, órgãos unicamente respiratórios e não tem outras funções.





A DINÂMICA DA RESPIRAÇÃO


Pode dividir-se em distintos processos:
1. Inspiração: Consiste na entrada de ar até os alvéolos pulmonares. Ingressa oxigénio.
2. Processo de intercâmbio de oxigénio e bióxido de carbono entre os alvéolos pulmonares e o sangue; e transporte do sangue aos tecidos. Expiração Inspiração


3. Expiração: consiste na saída do ar dos alvéolos pulmonares para o exterior. Elimina-se bióxido de carbono.
O oxigénio ingressa pela narina, atravessa a faringe, a laringe e traqueia. A traqueia se ramifica em dois brônquios, que se dirigem cada um a um pulmão.
No pulmão os brônquios vão se dividindo e, ao mesmo tempo, diminuem seu calibre até formar os bronquíolos.
Esses continuam se dividindo em condutos ainda menores até o bronquíolo terminal ou respiratório, que formam finalmente os sacos aéreos ou alvéolos. Em volta de cada alvéolo há uma rede de capilares sanguíneos. Nos pulmões o oxigénio passa por difusão dos alvéolos aos capilares sanguíneos e o bióxido de carbono dos capilares para os alvéolos.
Nos tecidos corporais o oxigénio passa do sangue e líquidos corporais às células, e o bióxido de carbono no sentido oposto, também pelo processo de difusão. As funções metabólicas normais das células requerem um fornecimento constante de oxigénio e, por sua vez, produzem bióxido de carbono como resíduo, portanto a carga de bióxido de carbono nas células é maior e a de oxigénio é menor em relação à dos capilares, o que produz a difusão de uma zona de maior concentração a outra de menor.





Hematose Pulmonar





Curiosidades:

Os pulmões contêm quase 2400 quilómetros de vias aéreas e mais de 300 milhões de alvéolos.

As plantas são nossas parceiras na respiração. Nós inspiramos oxigénio e expiramos dióxido de carbono. As plantas absorvem o dióxido de carbono e largam oxigénio.

As pessoas têm tendência para apanhar mais constipações no Inverno porque passam mais tempo dentro de casa e mais tempo perto de outras pessoas. Quando uma pessoas espirra, tosse ou até mesmo respira, os germes passam para o ar.

Ciências Naturais - O Sistema Circulatório

Do sistema circulatório fazem parte o coração, que é o órgão central, as artérias, arteríolas e capilares que levam o sangue enriquecido em O2 aos tecidos e as veias que transportam o sangue com CO2, produto das trocas gasosas nos tecidos, até ao coração, que por sua vez o remete para os pulmões. O coração é constituído pelo miocárdio, que tem a particularidade de autogerar impulsos nervosos de uma maneira rítmica, conferindo-lhe a capacidade de se contrair e relaxar de acordo com a frequência determinada por esses impulsos. É este ritmo que captamos através da frequência cardíaca que, usualmente, se situa em repouso entre as 60 e 80 pulsações por minuto.

O sangue desempenha três funções essenciais: transportar oxigénio, distribuir os alimentos e remover o dióxido de carbono e outros detritos eliminados pelas células.

Em 1900, um biologista alemão, Karl Landsteiner, anunciou a descoberta dos chamados grupos sanguíneos - A, B, AB ou O. Além disso, descobriu também a existência de uma substância nos glóbulos vermelhos, factor Rh (as pessoas que possuem essa substância são Rh positivas e as que não possuem são Rh negativas). Isto faz com que o conjunto dos diversos grupos sanguíneos que hoje se podem identificar à superfície dos glóbulos vermelhos de uma pessoa a tornem perfeitamente individualizável e distinta de qualquer outra.

Vasos sanguíneos : existem três tipos de vasos sanguíneos: artérias, veias e capilares.
Artérias: a sua função é levar o sangue desde o coração até os tecidos. Três capas formam as suas paredes, a externa ou adventícia de tecido conjuntivo; a capa media de fibras musculares lisas, e a interna ou íntima formada por tecidos conectivos, e por dentro dela se encontra uma capa muito delgada de células que constituem o endotélio.
Veias: devolvem o sangue dos tecidos ao coração. À semelhança das artérias, as suas paredes são formadas por três capas, diferenciando-se das anteriores somente por sua menor espessura, sobretudo ao diminuir a capa media. As veias têm válvulas que fazem com que o sangue circule desde a periferia rumo ao coração ou seja, que levam a circulação centrípeta.
Capilares: são vasos microscópicos situados nos tecidos, que servem de conexão entre as veias e as artérias; sua função mais importante é o intercâmbio de materiais nutritivos, gases e desperdícios entre o sangue e os tecidos. As suas paredes compõem-se de uma só capa celular, o endotélio, que se prolonga com o mesmo tecido das veias e artérias em seus extremos.
O sangue não se põe em contacto directo com as células do organismo, se bem que estas são rodeadas por um líquido intersticial que as recobre; as substâncias se difundem, desde o sangue pela parede de um capilar, por meio de poros que contém os mesmos e atravessa o espaço ocupado por líquido intersticial para chegar às células.
As artérias antes de se transformarem em capilares são um pouco menores e chamam-se arteríolas, e o capilar quando passa a ser veia novamente tem uma passagem intermediária nas que são veias menores chamadas vénulas; os esfíncteres pré-capilares ramificam os canais principais, abrem ou fecham outras partes do leito capital para satisfazer as variadas necessidades do tecido. Dessa maneira, os esfíncteres e o músculo liso de veias e artérias regulam o fornecimento do sangue aos órgãos.

Ciências Naturais - O Sistema Digestivo


O sistema digestivo ou gastrointestinal inclui o tubo digestivo (que é constituído por: boca, faringe, esófago, estômago, intestino delgado, intestino grosso e recto), e órgãos glandulares (glândulas salivares, glândulas estomacais, fígado e pâncreas) que segregam substâncias que lançam no interior desse tubo.

A função deste aparelho é transferir as moléculas orgânicas, água e sais minerais que constituem a alimentação para o meio interno do organismo, de modo a que os átomos e moléculas que os constituem possam ser distribuídos pelas células através do sistema circulatório.
O tubo digestivo de um adulto mede aproximadamente 8/9 metros de comprimentos desde a boca até ao ânus, e o seu interior está em contacto com o exterior através desses dois orifícios, o que quer dizer que, em sentido estrito, o conteúdo do tubo digestivo é exterior ao corpo humano. Ao contrário do que geralmente se imagina, a eliminação de produtos desnecessários (excreção) não é uma função principal do aparelho digestivo. O maior responsável pela eliminação dos resíduos é, no corpo humano, o aparelho renal, enquanto que as fezes são, maioritariamente, constituídas por materiais não digeridos e por bactérias que residem no tubo digestivo, isto é, por materiais que nunca penetram, de facto, no corpo humano.

A digestão

As substâncias simples da nossa dieta, como a água, os sais minerais e as vitaminas (excepto a vitamina B12), podem ser absorvidas ao longo do tubo digestivo sem sofrerem transformações. Contudo, as macromoléculas, como proteínas, gorduras e hidratos de carbono, têm de ser transformadas em moléculas pequenas e menos complexas para serem absorvidas. As proteínas são desdobradas em polipéptidos, péptidos e aminoácidos. Os hidratos de carbono são transformados em açúcares simples (monossacarídeos) como a glicose, a frutose e a galactose, entre outros. As gorduras são parcialmente separadas em ácidos gordos e glicerinas. A transformação dos alimentos ocorre ao longo do tubo digestivo por acção de fenómenos mecânicos e químicos que, no seu conjunto, constituem a digestão.
Para executar estas transformações, o aparelho digestivo realiza três tipos distintos de actividades, que tornam máximo o aproveitamento dos nutrientes: secreção, movimento e absorção. A digestão é uma função que se desenrola de forma sequencial, isto é, trata-se de um conjunto de fenómenos que acontecem sucessivamente, de acordo com uma determinada ordem.
Esta função recebe o contributo de agentes que são produzidos por alguns desses órgãos, ou então segregados por glândulas secretoras que lhes estão associadas e que, pela sua natureza, auxiliam a transformação dos alimentos em entidades químicas mais simples (secreção).
A esta acção de ataque químicos também se associam, ao longo do trajecto do tubo digestivo, vários outros efeitos mecânicos que resultam da contracção das paredes de alguns órgãos que o constituem. Por exemplo, o estômago, ao contrair-se de forma própria, mistura o seu conteúdo com grande eficiência, e o esófago e o intestino delgado contribuem, com as suas contracções, para o avanço dos materiais ao longo do percurso (movimento).
As moléculas resultantes do processo digestivos são capazes de atravessar as paredes do intestino delgado, através de uma camada de células epiteliais, para se integrarem no sangue ou na linfa (absorção).
Residualmente, ficam no intestino materiais que o aparelho digestivo não transformou em substâncias assimiláveis e que elimina sob a forma de fezes.

Curiosidades:

Qual é o comprimento dos intestinos? Pelo menos 7,5 metros nos adultos. Se acham que é muito, dêem graças a Deus por não serem um cavalo adulto que tem nada mais nada menos do que 27 metros de intestino!

Mastigar comida demora entre 5 e 30 segundos.

Engolir demora cerca de 10 segundos

A comida pode andar às voltas no estômago durante 3 a 4 horas.

A comida demora 3 horas a atravessar o intestino.

A secagem e 'passeio' da comida pelo intestino grosso pode demorar entre 18 horas e 2 dias.

Durante uma vida, o sistema digestivo aguenta com 50 toneladas de comida.
Related Posts Plugin for WordPress, Blogger...

Mensagens populares

Emprego Docente

Noticias da Educação

Recomendamos ...